View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0278_low_11 (Length: 328)
Name: NF0278_low_11
Description: NF0278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0278_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 116; Significance: 5e-59; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 97 - 212
Target Start/End: Complemental strand, 5334300 - 5334185
Alignment:
| Q |
97 |
accgatcgctaatgaatcaacaaataccctcgtttcatcgccgtaaattctgtgtttagtagttatcattgttgatttgatttcaaaattatcgcaatct |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5334300 |
accgatcgctaatgaatcaacaaataccctcgtttcatcgccgtaaattctgtgtttagtagttatcattgttgatttgatttcaaaattatcgcaatct |
5334201 |
T |
|
| Q |
197 |
tctccttctaatccta |
212 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
5334200 |
tctccttctaatccta |
5334185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 281 - 328
Target Start/End: Complemental strand, 5334116 - 5334069
Alignment:
| Q |
281 |
ggtagtgttttcctaaaacctctatgatctacccttccgctttaaatt |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5334116 |
ggtagtgttttcctaaaacctctatgatctacccttccgctttaaatt |
5334069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1177 times since January 2019
Visitors: 2573