View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0279_high_13 (Length: 306)
Name: NF0279_high_13
Description: NF0279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0279_high_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 9e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 9e-67
Query Start/End: Original strand, 105 - 257
Target Start/End: Complemental strand, 7340405 - 7340253
Alignment:
Q |
105 |
ctcaagagaagaaaagatttttcaaaagtggaagaaaggttaggtaaatgtatacacgtagtagnnnnnnnnatagtagctagctagtgtgttagagtta |
204 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
7340405 |
ctcaagagaagaaaagatttttcaaaagtggaagaaaggttaggtaaatgtatacacgtagtagttttttttatagtagctagctagtgtgttagagtta |
7340306 |
T |
 |
Q |
205 |
aatgtgtccaattgatgtactttttataggtgatgaattggatatattttctt |
257 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7340305 |
aatgtgtccaattgatgtactttttataggtgatgaattggatatattttctt |
7340253 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University
This website was viewed 314 times since January 2019
Visitors: 5880