View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0279_high_14 (Length: 279)

Name: NF0279_high_14
Description: NF0279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0279_high_14
NF0279_high_14
[»] chr8 (1 HSPs)
chr8 (30-244)||(43183574-43183788)


Alignment Details
Target: chr8 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 30 - 244
Target Start/End: Complemental strand, 43183788 - 43183574
Alignment:
30 cggaggaggtggtggtgacggctgtgacaagggagaagtgcgtaggaatgaataacaagggagtgagttggggacatacttcggtgattggaagacggag 129  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43183788 cggaggaggtggtggtgacggctgtgacaagggagaagtgcgtaggaatgaataacaagggagtgagttggggacatacttcggtgattggaagacggag 43183689  T
130 agagatggaagacgccgtcgctgttattccgggattcatgtcacgcacttgcgatcacgtcggcggttgtactgctcctggttctagatcctccggcgag 229  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43183688 agagatggaagacgccgtcgctgttattccgggattcatgtcacgcacttgcgatcacgtcggcggttgtactgctcctggttctagatcctccggcgag 43183589  T
230 atcagtcctattcat 244  Q
    |||||||||||||||    
43183588 atcagtcctattcat 43183574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University