View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0279_low_19 (Length: 320)

Name: NF0279_low_19
Description: NF0279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0279_low_19
NF0279_low_19
[»] chr2 (1 HSPs)
chr2 (84-320)||(37978014-37978250)


Alignment Details
Target: chr2 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 84 - 320
Target Start/End: Original strand, 37978014 - 37978250
Alignment:
84 atatcagaacttgaagcaaggaaacgagtagaagacaaagtggattttctctgtgagcattgagtagttgctgagaatgacaaagaagttagtgcagcca 183  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
37978014 atatcagaacttgaagcaaggaaacgagtagaagacaaagtggattttctctgtgagcattgagaagttgctgagaatgacaaagaagttagtgcagcca 37978113  T
184 taactagaaactgaaagtacaagtaaagagaaaaggtagatgcaatattagactcagaaaatatccttcatgaaaaggaaggacaaaattcagagaagga 283  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37978114 taactagaaactgaaagtacaagtaaagagaaaaggtagatgcaatattagactcagaaaatatccttcatgaaaaggaaggacaaaattcagagaagga 37978213  T
284 actgcattgctttcaaaacatttgtgttggaaacaaa 320  Q
    |||||||||||||||||| ||||||||||||||||||    
37978214 actgcattgctttcaaaatatttgtgttggaaacaaa 37978250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1072 times since January 2019
Visitors: 2571