View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0279_low_19 (Length: 320)
Name: NF0279_low_19
Description: NF0279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0279_low_19 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 84 - 320
Target Start/End: Original strand, 37978014 - 37978250
Alignment:
| Q |
84 |
atatcagaacttgaagcaaggaaacgagtagaagacaaagtggattttctctgtgagcattgagtagttgctgagaatgacaaagaagttagtgcagcca |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
37978014 |
atatcagaacttgaagcaaggaaacgagtagaagacaaagtggattttctctgtgagcattgagaagttgctgagaatgacaaagaagttagtgcagcca |
37978113 |
T |
|
| Q |
184 |
taactagaaactgaaagtacaagtaaagagaaaaggtagatgcaatattagactcagaaaatatccttcatgaaaaggaaggacaaaattcagagaagga |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37978114 |
taactagaaactgaaagtacaagtaaagagaaaaggtagatgcaatattagactcagaaaatatccttcatgaaaaggaaggacaaaattcagagaagga |
37978213 |
T |
|
| Q |
284 |
actgcattgctttcaaaacatttgtgttggaaacaaa |
320 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |
|
|
| T |
37978214 |
actgcattgctttcaaaatatttgtgttggaaacaaa |
37978250 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1072 times since January 2019
Visitors: 2571