View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0279_low_25 (Length: 306)
Name: NF0279_low_25
Description: NF0279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0279_low_25 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 93; Significance: 3e-45; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 125 - 228
Target Start/End: Complemental strand, 9746604 - 9746500
Alignment:
| Q |
125 |
tagaacaaaaaacgcaaagccttaagaaatgaaaatgactatttatcaag-agatgttatctagttgatattttattcataaaaaattgcacgatacaag |
223 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9746604 |
tagaacaaaaaatgcaaagccttaagaaatgaaaatgactatttatcaaggagatgttatctagttgatattttattcataaaaaattgcacgatacaag |
9746505 |
T |
|
| Q |
224 |
ttcat |
228 |
Q |
| |
|
||||| |
|
|
| T |
9746504 |
ttcat |
9746500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 812 times since January 2019
Visitors: 2568