View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0279_low_26 (Length: 305)
Name: NF0279_low_26
Description: NF0279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0279_low_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 1 - 162
Target Start/End: Original strand, 642027 - 642185
Alignment:
| Q |
1 |
gacaccttagtttatcgaatgaagttgcttatgaatctaaagaggtaatgtagcaaaaatacatatattccatttccaccgatgaaagagaaaattttca |
100 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||| ||| |||||||||||| |||||| |||||||||| ||||||||||||| ||| |
|
|
| T |
642027 |
gacaccttagtttattgaatgaagttgcttatgaatctaaagaggcaatatagcaaaaatacttatatttcatttccaccaatgaaagagaaaa---tca |
642123 |
T |
 |
| Q |
101 |
attgtaagcaaatctttaaaggacacaaatatcacaaaacgtaatagtaaagtaaaagaata |
162 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
642124 |
attgtaagcaaatcttcaaaggacacaaatatcacaaaacgtaatagtaaagtaaaagaata |
642185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 159 - 226
Target Start/End: Original strand, 38816865 - 38816932
Alignment:
| Q |
159 |
aatataccatattacattaattgaattgtaaaacccaactatttttaacctgcagcgactctctgttg |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38816865 |
aatataccatattacattaattgaattgtaaaacccaactatttttaacctgcagcgactctctgttg |
38816932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University