View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0279_low_31 (Length: 287)
Name: NF0279_low_31
Description: NF0279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0279_low_31 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 7e-92; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 67 - 241
Target Start/End: Complemental strand, 37628899 - 37628725
Alignment:
| Q |
67 |
gtttttagaagggaagtcggaggagagtgtgaagatgattgcagaaagtaatccgtttggtagaattggtgagactaaagatatttcgcctgttgttggg |
166 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37628899 |
gtttttagaagggaagtcggaggagagggtgaagatgattgcagaaagtaatccgtttggtagaattggtgagactaaagatatttcgcctgttgttggg |
37628800 |
T |
|
| Q |
167 |
tttttggcatctgattctggtgaatgggttaatgctcaaattattcgtgtcaatggtggctttgtttagttcatc |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37628799 |
tttttggcatctgattctggtgaatgggttaatgctcaaattattcgtgtcaatggtggctttgtttagttcatc |
37628725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 118 - 237
Target Start/End: Complemental strand, 37622009 - 37621890
Alignment:
| Q |
118 |
tccgtttggtagaattggtgagactaaagatatttcgcctgttgttgggtttttggcatctgattctggtgaatgggttaatgctcaaattattcgtgtc |
217 |
Q |
| |
|
||||||||||||| ||||||||||||||||| || | ||||||||||| |||||||| ||||| || |||||||||||||| ||||||||||||||| |
|
|
| T |
37622009 |
tccgtttggtagacttggtgagactaaagatgttgctcctgttgttggttttttggctactgatgcttctgaatgggttaatggtcaaattattcgtgtt |
37621910 |
T |
|
| Q |
218 |
aatggtggctttgtttagtt |
237 |
Q |
| |
|
|| ||||||| ||||||||| |
|
|
| T |
37621909 |
aacggtggctatgtttagtt |
37621890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 49; Significance: 5e-19; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 132 - 236
Target Start/End: Complemental strand, 29504585 - 29504481
Alignment:
| Q |
132 |
ttggtgagactaaagatatttcgcctgttgttgggtttttggcatctgattctggtgaatgggttaatgctcaaattattcgtgtcaatggtggctttgt |
231 |
Q |
| |
|
||||||||||||||||| || | ||| | |||||||||||||| |||||| |||||||||||||||||| ||| |||||||| | |||||||| | ||| |
|
|
| T |
29504585 |
ttggtgagactaaagatgttgctcctttggttgggtttttggcttctgatgctggtgaatgggttaatggtcagattattcgaattaatggtggttatgt |
29504486 |
T |
|
| Q |
232 |
ttagt |
236 |
Q |
| |
|
||||| |
|
|
| T |
29504485 |
ttagt |
29504481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 161 - 236
Target Start/End: Original strand, 8806798 - 8806873
Alignment:
| Q |
161 |
gttgggtttttggcatctgattctggtgaatgggttaatgctcaaattattcgtgtcaatggtggctttgtttagt |
236 |
Q |
| |
|
|||||||||||||| ||| || |||||||||||||||||| | | |||||||| | |||||||| | |||||||| |
|
|
| T |
8806798 |
gttgggtttttggcttctaatgctggtgaatgggttaatggttagattattcggattaatggtggttatgtttagt |
8806873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1094 times since January 2019
Visitors: 2571