View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0279_low_34 (Length: 279)
Name: NF0279_low_34
Description: NF0279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0279_low_34 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 30 - 244
Target Start/End: Complemental strand, 43183788 - 43183574
Alignment:
Q |
30 |
cggaggaggtggtggtgacggctgtgacaagggagaagtgcgtaggaatgaataacaggggagtgagttggggacatacttcggtgattggaagacggag |
129 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43183788 |
cggaggaggtggtggtgacggctgtgacaagggagaagtgcgtaggaatgaataacaagggagtgagttggggacatacttcggtgattggaagacggag |
43183689 |
T |
 |
Q |
130 |
agagatggaagacgccgtcgctgttattccgggattcatgtcacgcacttgcgatcacgtcggcggttgtactgctcctggttctagatcctccggcgag |
229 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43183688 |
agagatggaagacgccgtcgctgttattccgggattcatgtcacgcacttgcgatcacgtcggcggttgtactgctcctggttctagatcctccggcgag |
43183589 |
T |
 |
Q |
230 |
atcagtcctattcat |
244 |
Q |
|
|
||||||||||||||| |
|
|
T |
43183588 |
atcagtcctattcat |
43183574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University