View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0280-Insertion-4 (Length: 277)
Name: NF0280-Insertion-4
Description: NF0280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0280-Insertion-4 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 171; Significance: 7e-92; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 56 - 277
Target Start/End: Original strand, 20551880 - 20552098
Alignment:
| Q |
56 |
tattgattgtgaagaagaaaaatggtgacttacaattgaaggaattaagatcgttgaagaaaaatgatgaaatgatagaatttggtgagaaagtgtttgg |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
20551880 |
tattgattgtgaagaagaaaaatggtgacttacaattgaaggaattaagatcgttgaagaaaaatgatgaaatgat-gaatttgttgagaaagtgtttgg |
20551978 |
T |
 |
| Q |
156 |
aattttggtgagaaagtgttgttctttgtcaccgattgttcaagcttcttcacgctcacacaaaacgcacttttagttctaagctannnnnnnnngtctg |
255 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
20551979 |
aattttggtgagaaagtgttgtactttgtcaccgattgttcaagcttcttcacgctcacacaaaacgcacttttagttctaagct--ttttttttgtctg |
20552076 |
T |
 |
| Q |
256 |
aaatgaaattttacttgggtta |
277 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
20552077 |
aaatgaaattttacttgggtta |
20552098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University