View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0280_high_7 (Length: 305)
Name: NF0280_high_7
Description: NF0280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0280_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 32 - 297
Target Start/End: Complemental strand, 14034387 - 14034122
Alignment:
Q |
32 |
cgggtcaactcatgaatcccaaattcacctgcaaattcctccaaaaaacgaagcacttcttgatgacccggaaacgttcttggatcaccggaatctcgct |
131 |
Q |
|
|
||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| || ||||||| |
|
|
T |
14034387 |
cgggtcaactcatgaatcccaaactcatctgcaaattcctccaaaaaacgaagcacttcttcatgacccggaaacgttctcggatcaccagattctcgct |
14034288 |
T |
 |
Q |
132 |
tggacaaagggtaatctaagaaccccatgatatgtcttggaagatttgtgcgtagcgagtggtagacactgctgtgaactgtttctcttgttgggtctat |
231 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||| |||| || ||||||||||||||||||| ||||| || || |
|
|
T |
14034287 |
tggacaaagggtaatctaagaaccccatgatatgtcttggaagattggtgcgtagtgagaggtacacgctgctgtgaactgtttctcgggttggatcaat |
14034188 |
T |
 |
Q |
232 |
gctaagaggatcggagtctgatttagaggtgtatatccaggttcctccaacacggttgttcatctc |
297 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| |
|
|
T |
14034187 |
gctaagaggatcggagtctgatttagaggtgtatatccaggttcctccgacacggttgttcttctc |
14034122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 29 - 297
Target Start/End: Original strand, 14045874 - 14046142
Alignment:
Q |
29 |
aatcgggtcaactcatgaatcccaaattcacctgcaaattcctccaaaaaacgaagcacttcttgatgacccggaaacgttcttggatcaccggaatctc |
128 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
T |
14045874 |
aatcgggtcaactcatgaatcccaaattcacctgcaaattcctccaaaaaacgaagcacttcttcatgacccggaaacgttcttggatcaccggattctc |
14045973 |
T |
 |
Q |
129 |
gcttggacaaagggtaatctaagaaccccatgatatgtcttggaagatttgtgcgtagcgagtggtagacactgctgtgaactgtttctcttgttgggtc |
228 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||||||||||||| ||||| || |||||||| || |||||||||||||||||||| | ||||| |
|
|
T |
14045974 |
tcttggacaaagggtaatctaagaaccccatgatttgtcttggaagattggtgcgcagagagtggtatacgctgctgtgaactgtttctctggccgggtc |
14046073 |
T |
 |
Q |
229 |
tatgctaagaggatcggagtctgatttagaggtgtatatccaggttcctccaacacggttgttcatctc |
297 |
Q |
|
|
||||| |||||||||||||||| ||| | ||||||||||||||||||||| |||||||||||| |||| |
|
|
T |
14046074 |
catgcttagaggatcggagtctgtttttggggtgtatatccaggttcctcccacacggttgttcttctc |
14046142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University