View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0280_low_5 (Length: 366)
Name: NF0280_low_5
Description: NF0280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0280_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 76 - 290
Target Start/End: Original strand, 29863852 - 29864072
Alignment:
| Q |
76 |
cagattggagatatgggaattgtg--aggaccagtttgtattttgcaatgtaatgttatcctttaggtaagatttatgtaagattcttttggttagatta |
173 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29863852 |
cagattggagatatgggaattgtgtgaggaccagtttgtattttgcaatgtaatgttatcctttaggtaagatttatgtaagattcttttggttagatta |
29863951 |
T |
 |
| Q |
174 |
----agtgcataaaatataatattcaacatacaaaacagtagtactaaattctaaaatatctttgcagttatgacataaattatacaaggctagcatgat |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29863952 |
attaagtgcataaaatataatattcaacatacaaaacagtagtactaaattctaaaatatctttgcagttatgacataaattatacaaggctagcatgat |
29864051 |
T |
 |
| Q |
270 |
tcatattaatgataggtatga |
290 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
29864052 |
tcatattaatgataggtatga |
29864072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 7 - 41
Target Start/End: Original strand, 43490135 - 43490169
Alignment:
| Q |
7 |
cttgctgctttgaatggatctcttatctctgctgc |
41 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
43490135 |
cttgctgctttgaatggatctcttatctctgctgc |
43490169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University