View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0282_low_3 (Length: 503)
Name: NF0282_low_3
Description: NF0282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0282_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 1e-76; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 1e-76
Query Start/End: Original strand, 254 - 399
Target Start/End: Original strand, 34120766 - 34120911
Alignment:
| Q |
254 |
atattatatgatgagttgatacacatgggctgaaagagtcatggctgatgatgagtctataagccactcaattgttttaccaatgggaccctttcatatt |
353 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34120766 |
atattatatgatgagttgatacacatgggctgaaagagtcatggctgatgatgagtctataagccactcaattgttttaccaatgggaccctttcatatt |
34120865 |
T |
 |
| Q |
354 |
gatgatagcaagaaattcacaacattatgatccatcataaacatta |
399 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34120866 |
gatgatagcaagaaattcacaacattatgatccatcataaacatta |
34120911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 48 - 190
Target Start/End: Original strand, 34120563 - 34120705
Alignment:
| Q |
48 |
attttatatatacggttgaatttggtttagttcggtttcaaggaataatcaaaaatctaatacaatcgtagtgannnnnnnatcaaacatatccactata |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
34120563 |
attttatatatacggttgaatttggtttagttcggtttcaaagaataatcagaaatctaatacaattgtagtgatttttttatcaaacatatccactata |
34120662 |
T |
 |
| Q |
148 |
tactagctttatgctgtttttcaataacatttttttaattctt |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34120663 |
tactagctttatgctgtttttcaataacatttttttaattctt |
34120705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University