View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0282_low_8 (Length: 345)
Name: NF0282_low_8
Description: NF0282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0282_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 145; Significance: 3e-76; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 63 - 270
Target Start/End: Original strand, 10526524 - 10526738
Alignment:
| Q |
63 |
tcaatgtttataccagaggcattaatcctaagagtgacatgtctcagttctgattccctcatcccattggaaaaaagctgcaacaggtaaataaacactg |
162 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
10526524 |
tcaatgtttataccagaggcattaattctaagggtgacatgtctcagttccgattccctcatcccattcgaaaaaagctgcaaaaggtaaataaacactg |
10526623 |
T |
|
| Q |
163 |
ctaagaaaacaaatttttggcaaaactatacaatg-------taaagatatagagatcttggtctgccttatagaagaacggacttttagcagccaagat |
255 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||| |||||||||||||| |||||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
10526624 |
ctaagaaaacatatttttggcagaactatacaatgtacaatataaagatatagagaacttggtctaccttatagaagaacgggcttttagcagccaagat |
10526723 |
T |
|
| Q |
256 |
cagagaactgatatg |
270 |
Q |
| |
|
| ||||||||||||| |
|
|
| T |
10526724 |
cggagaactgatatg |
10526738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 269 - 335
Target Start/End: Original strand, 10526760 - 10526826
Alignment:
| Q |
269 |
tgcagcttcagagtaatccatgcccaggttgggttcatcattgtcttttacaacctcatcacctatg |
335 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
10526760 |
tgcaggttcagagtaatccatgcccaggttgggttcatcattgtcgtttacagcctcatcacctatg |
10526826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 59; Significance: 6e-25; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 269 - 335
Target Start/End: Complemental strand, 923940 - 923874
Alignment:
| Q |
269 |
tgcagcttcagagtaatccatgcccaggttgggttcatcattgtcttttacaacctcatcacctatg |
335 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
923940 |
tgcagcttcagagcaatccatgcccaggttaggttcatcattgtcttttacaacctcatcacctatg |
923874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 249 times since January 2019
Visitors: 2563