View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0283_low_4 (Length: 338)
Name: NF0283_low_4
Description: NF0283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0283_low_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 55 - 327
Target Start/End: Complemental strand, 1792324 - 1792052
Alignment:
| Q |
55 |
tttgtccctagaaaatttgctaatacaaaaaactaatcatatagttcttttgtgataatttctcaatctgcctgtgcgaccccattagctatcgaaaggt |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1792324 |
tttgtccctagaaaatttgctaatacaaaaaactaatcatatagttcttttgtgataatttctcaatctgcctgtatgaccccattagctatcgaaaggt |
1792225 |
T |
 |
| Q |
155 |
cctttcaataatatattttagccgaaataatatcgaaaggatccattcgatagtgtattttgagggcctatgagcatataagagggtgaattgagaaatt |
254 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||||||||||||| | ||||||||||||||| ||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
1792224 |
cctttcaataatgtattttatccgaaataatatcgaaaggatccttccgatagtgtattttgggggcctatgagcatataagggggtgaattgagaaatt |
1792125 |
T |
 |
| Q |
255 |
atattttcataattttagaattatgttgagcagggttttaataggcccattaatgccttttccctagagaatt |
327 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
1792124 |
atatttttataattttagaattatgttgagcagggttttaataggcccattgatgccttttccttagagaatt |
1792052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University