View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0285_high_5 (Length: 216)
Name: NF0285_high_5
Description: NF0285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0285_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 164 - 208
Target Start/End: Complemental strand, 7426274 - 7426230
Alignment:
Q |
164 |
acatttatcatccttcttctctttacccgccgccgtcttcatctc |
208 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
7426274 |
acatttatcatccttcttctctttacccgccgccgtcttcgtctc |
7426230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University