View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0285_high_5 (Length: 216)

Name: NF0285_high_5
Description: NF0285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0285_high_5
NF0285_high_5
[»] chr8 (1 HSPs)
chr8 (164-208)||(7426230-7426274)


Alignment Details
Target: chr8 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 164 - 208
Target Start/End: Complemental strand, 7426274 - 7426230
Alignment:
164 acatttatcatccttcttctctttacccgccgccgtcttcatctc 208  Q
    |||||||||||||||||||||||||||||||||||||||| ||||    
7426274 acatttatcatccttcttctctttacccgccgccgtcttcgtctc 7426230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 800 times since January 2019
Visitors: 2568