View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0285_low_1 (Length: 382)
Name: NF0285_low_1
Description: NF0285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0285_low_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 13 - 285
Target Start/End: Original strand, 39168638 - 39168910
Alignment:
Q |
13 |
aatatccatgctgaccagttgccaaataaaatagcacttcctgtgaaaggacaaaatcttgtaactcagctgtaccacaaatgtctaccgtattcaacga |
112 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
39168638 |
aatatccatgctgaccagttgccaaataaaatagcacttcctgtgaaaggacaaaatcttgtaactcagctgtaccacaaatgtctacggtattcaacga |
39168737 |
T |
 |
Q |
113 |
acttccttacttgcaagttgcaacatagcacataggaaaatagggaaaattagggagggtgtgaaaatggagtaatatctcttgatttttctccttgatt |
212 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39168738 |
acttccttacttgcaagttgcaacatagcacataggaaaatagggaaaattagggagggtgtgaaaatggagtaatatctcttgatttttctccttgatt |
39168837 |
T |
 |
Q |
213 |
agttttgcttttgatgatatggaaaataattttcaggtctcttcaatacaaaaggaaaagtaaccgaggaatc |
285 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39168838 |
agttttgcttttgatgatatggaaaataattttcaggtctcttcaatacaaaaggaaaagtaaccgaggaatc |
39168910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University