View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0285_low_1 (Length: 382)

Name: NF0285_low_1
Description: NF0285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0285_low_1
NF0285_low_1
[»] chr1 (1 HSPs)
chr1 (13-285)||(39168638-39168910)


Alignment Details
Target: chr1 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 13 - 285
Target Start/End: Original strand, 39168638 - 39168910
Alignment:
13 aatatccatgctgaccagttgccaaataaaatagcacttcctgtgaaaggacaaaatcttgtaactcagctgtaccacaaatgtctaccgtattcaacga 112  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
39168638 aatatccatgctgaccagttgccaaataaaatagcacttcctgtgaaaggacaaaatcttgtaactcagctgtaccacaaatgtctacggtattcaacga 39168737  T
113 acttccttacttgcaagttgcaacatagcacataggaaaatagggaaaattagggagggtgtgaaaatggagtaatatctcttgatttttctccttgatt 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39168738 acttccttacttgcaagttgcaacatagcacataggaaaatagggaaaattagggagggtgtgaaaatggagtaatatctcttgatttttctccttgatt 39168837  T
213 agttttgcttttgatgatatggaaaataattttcaggtctcttcaatacaaaaggaaaagtaaccgaggaatc 285  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39168838 agttttgcttttgatgatatggaaaataattttcaggtctcttcaatacaaaaggaaaagtaaccgaggaatc 39168910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University