View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0285_low_7 (Length: 241)
Name: NF0285_low_7
Description: NF0285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0285_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 7080932 - 7081151
Alignment:
Q |
1 |
ctagggtggattggatcaatttgcttgaaaggttgaaatctcagaattatcctttatacttcaaggtaactgttgcatagcatttctagnnnnnnngagc |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||| |
|
|
T |
7080932 |
ctagggtggattggatcaatttgcttgaaaggttgaaatctcagaattatcctttatacttcaaggtaactgttgcattgcctttctagtttttttgagc |
7081031 |
T |
 |
Q |
101 |
aatgggattttccatatagattacccgtgtatgtatgtgaatttgttttaatactttagcagattactgttattaggaaatgttatctgatgtgataaga |
200 |
Q |
|
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
7081032 |
aatgggattttccatatagattacctgtgtatgtatgtgaatttgttttaatactttagcagattactgttattaggaaatgttatctaatgtgataaga |
7081131 |
T |
 |
Q |
201 |
ttttgttgttgatgatgatg |
220 |
Q |
|
|
|||||||||||||||||||| |
|
|
T |
7081132 |
ttttgttgttgatgatgatg |
7081151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University