View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0287_high_23 (Length: 221)
Name: NF0287_high_23
Description: NF0287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0287_high_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 142
Target Start/End: Original strand, 46873870 - 46874011
Alignment:
| Q |
1 |
atctgaagtgtccatgatacgtatgttaatgttgactaactttatgttgttttgttgctgtttaatagtggaatggtggacaagttagctatgtgattcg |
100 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46873870 |
atctgaagtgtccatgatacatatgctaatgttgactaactttatgttgttttgttgctgtttaatagtggaatggtggacaagttagctatgtgattcg |
46873969 |
T |
|
| Q |
101 |
gaaggccaatacttcatggatacaaccaaagtggggtgcctc |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
46873970 |
gaaggccaatacttcatggatacaaccaaaatggggtgcctc |
46874011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 758 times since January 2019
Visitors: 2568