View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0287_high_24 (Length: 202)

Name: NF0287_high_24
Description: NF0287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0287_high_24
NF0287_high_24
[»] chr2 (1 HSPs)
chr2 (1-124)||(9233873-9233996)


Alignment Details
Target: chr2 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 1 - 124
Target Start/End: Complemental strand, 9233996 - 9233873
Alignment:
1 tattctcttccttggcttcttctgttaccacttccttggtctcaacttcaactggatcttgtgtttctacagcagctggagtttcttctgttgtttctgt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
9233996 tattctcttccttggcttcttctgttaccacttccttggtctcaacttcaactggatcttgtgtttctacggcagctggagtttcttctgttgtttctgt 9233897  T
101 tggctgttcggttgtttcttctgt 124  Q
    ||||||||||||||||||||||||    
9233896 tggctgttcggttgtttcttctgt 9233873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University