View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0287_low_1 (Length: 427)
Name: NF0287_low_1
Description: NF0287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0287_low_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 363; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 363; E-Value: 0
Query Start/End: Original strand, 30 - 415
Target Start/End: Complemental strand, 24782361 - 24781975
Alignment:
Q |
30 |
taacggcactgttactcttagccattatctccaccgttacctccaccgttaactcatgtcttccatcagaactcaaagccctacaagccataaaagcctc |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
24782361 |
taacggcactgttactcttagccattatctccaccgttacctccaccgctaactcatgtcttccatcagaactcaaagccctacaagccataaaagcctc |
24782262 |
T |
 |
Q |
130 |
actccgtgaacctaacgacggagtattcaactcatggaccggaactgactgctgccacaactggttgggcgtatcatgcgacgagaatactcgtcgtgta |
229 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
T |
24782261 |
actccgtgaacctaacgacggaatattcaactcatggaccggaactgactgctgccacaactggttgggcgtatcatgcgacgagaatactcgtcgcgta |
24782162 |
T |
 |
Q |
230 |
gccgatataaacctccgtgccggaactctctacaccaccttcgaaaaagcacgtaaacctggctacatgaccggtcaaatctccccggagatttgtaagc |
329 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
24782161 |
gccgatataaacctccgtgccggaactctctacaccaccttcgaaaaagcacgtaaacctggctacatgaccggtcaaatctccccggagatttgtaagc |
24782062 |
T |
 |
Q |
330 |
taactcaactttcaagcattacaatcactgattggaacggtatctccggtgagatccccaagtgcatttcttcac-ttctttccttc |
415 |
Q |
|
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
24782061 |
taactaaactttcaagcattacaatcactgattggaacggtatctccggtgagatccccaagtgcatttcttcactttctttccttc |
24781975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 293 times since January 2019
Visitors: 2564