View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0287_low_17 (Length: 283)
Name: NF0287_low_17
Description: NF0287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0287_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 126; Significance: 5e-65; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 105 - 262
Target Start/End: Complemental strand, 7340405 - 7340249
Alignment:
| Q |
105 |
ctcaagagaagaaaagatttttcaaaagtggaagaaaggttaggtaaatgtatacacgtagtagnnnnnnnnnatagtagctagctagtgtgttagagtt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
7340405 |
ctcaagagaagaaaagatttttcaaaagtggaagaaaggttaggtaaatgtatacacgtagtagtttttttt-atagtagctagctagtgtgttagagtt |
7340307 |
T |
|
| Q |
205 |
aaatgtgtccaattgatgtactttttataggtgatgaattggatatattttcttggac |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7340306 |
aaatgtgtccaattgatgtactttttataggtgatgaattggatatattttcttggac |
7340249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 778 times since January 2019
Visitors: 2568