View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0287_low_19 (Length: 277)
Name: NF0287_low_19
Description: NF0287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0287_low_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 9e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 9e-73
Query Start/End: Original strand, 41 - 221
Target Start/End: Original strand, 1414356 - 1414531
Alignment:
| Q |
41 |
atgaagattttacctgcagaaaacacaaatagttt-atttacaaattaattgtgcattaccaccatcatcattaattactgtgagtgtgatagagaagag |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1414356 |
atgaagattttacctgcagaaaacacaaatagttttatttacaaattaattgtgcgttaccaccatcatcattaattactgtg------atagagaagag |
1414449 |
T |
 |
| Q |
140 |
aaattaagaaacacataccacaaacttgtgctgatgaacttttccatttgcagtatgaatcagaaaaacataaagtatagag |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
1414450 |
aaattaagaaacacataccacaaacttgtgatgatgaacttttccatttgcagtatgaatcagataaacataaagtatagag |
1414531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University