View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0287_low_19 (Length: 277)

Name: NF0287_low_19
Description: NF0287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0287_low_19
NF0287_low_19
[»] chr2 (1 HSPs)
chr2 (41-221)||(1414356-1414531)


Alignment Details
Target: chr2 (Bit Score: 139; Significance: 9e-73; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 139; E-Value: 9e-73
Query Start/End: Original strand, 41 - 221
Target Start/End: Original strand, 1414356 - 1414531
Alignment:
Q  41 atgaagattttacctgcagaaaacacaaatagttt-atttacaaattaattgtgcattaccaccatcatcattaattactgtgagtgtgatagagaagag 139  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||      |||||||||||    
T  1414356 atgaagattttacctgcagaaaacacaaatagttttatttacaaattaattgtgcgttaccaccatcatcattaattactgtg------atagagaagag 1414449  T
Q  140 aaattaagaaacacataccacaaacttgtgctgatgaacttttccatttgcagtatgaatcagaaaaacataaagtatagag 221  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||    
T  1414450 aaattaagaaacacataccacaaacttgtgatgatgaacttttccatttgcagtatgaatcagataaacataaagtatagag 1414531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 6491 times since January 2019
Visitors: 9254