View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0287_low_29 (Length: 202)
Name: NF0287_low_29
Description: NF0287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0287_low_29 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 1 - 124
Target Start/End: Complemental strand, 9233996 - 9233873
Alignment:
| Q |
1 |
tattctcttccttggcttcttctgttaccacttccttggtctcaacttcaactggatcttgtgtttctacagcagctggagtttcttctgttgtttctgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
9233996 |
tattctcttccttggcttcttctgttaccacttccttggtctcaacttcaactggatcttgtgtttctacggcagctggagtttcttctgttgtttctgt |
9233897 |
T |
|
| Q |
101 |
tggctgttcggttgtttcttctgt |
124 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
9233896 |
tggctgttcggttgtttcttctgt |
9233873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 818 times since January 2019
Visitors: 2568