View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0288-INSERTION-6 (Length: 279)
Name: NF0288-INSERTION-6
Description: NF0288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0288-INSERTION-6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 7 - 245
Target Start/End: Original strand, 12606442 - 12606677
Alignment:
| Q |
7 |
atatggcaccttcttttgacattactagtcacactgtttgtgtcatggatgcttcaggtcaattaggctttagccttgttcaaagacttcttcaaagaga |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12606442 |
atatggcaccttcttttgacattactagtcacactgtttgtgtcatggatgcttcaggtcaattaggctttagccttgttcaaagacttcttcaaagagg |
12606541 |
T |
 |
| Q |
107 |
ctataccgttcatgcatccattcaacaatatggtacatattatgtcattaattgcttttttattttgtcaaattcatcttaagaaaataagtggagaatt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| | || | | | ||| |
|
|
| T |
12606542 |
ctataccgttcatgcatccattcaacaatatggtacatattatgttattaattgcttttttattttgtcaaattca--ataagtggagaattcgtg-att |
12606638 |
T |
 |
| Q |
207 |
cgaactctcatcactgcatatctcaatattcttatcaat |
245 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
12606639 |
cgaactctgatcactgcatatctcaatattcttatcaat |
12606677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University