View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0288-INSERTION-7 (Length: 341)
Name: NF0288-INSERTION-7
Description: NF0288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0288-INSERTION-7 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 9 - 341
Target Start/End: Complemental strand, 43459117 - 43458784
Alignment:
| Q |
9 |
tctccattgtcttatgctttcaatgcattttctgtgaatgaaatgtttgctcctaggtggagcaaaccggtaagttctatcatatttctcgccacaatat |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43459117 |
tctccattgtcttatgctttcaatgcattttctgtgaatgaaatgtttgctcctaggtggagcaaaccggtaagtactatcatatttctcgccacaatat |
43459018 |
T |
|
| Q |
109 |
gaaaatgtgattaaaaggttactagtccctaataaatttcaagattttgtttttagtctctataaaattttgtgactaaaaccggtgacggaaaacattg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43459017 |
gaaaatgtgattaaaaggttactagtccctaataaatttcaagattttgtttttagtctctataaaattttgtgactaaaaccggtgatggaaaacattg |
43458918 |
T |
|
| Q |
209 |
tgggactaaaatttgaatttgtcttatatagact-aaacaaaattttaaaattttacggagactaataatatattaaccccaacttatatttctgacttg |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| || |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
43458917 |
tgggactaaaatttgaatttgtcttatatagactaaaaaaaaattttaaaattttagggggactaataatatattaacccaaacttatatttctgacttg |
43458818 |
T |
|
| Q |
308 |
atattttcatattttgcagtcttcagatggtttt |
341 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
43458817 |
atattttcatattttgcagtcttcagatggtttt |
43458784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 355 times since January 2019
Visitors: 2564