View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0288-INSERTION-8 (Length: 234)
Name: NF0288-INSERTION-8
Description: NF0288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0288-INSERTION-8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 57 - 233
Target Start/End: Original strand, 7945064 - 7945240
Alignment:
| Q |
57 |
ttttacaagttatgtgagtctcatattaaatacttaatgttcagactgtagctgtgaagactctgaacagggatgggaatcagggaacaagagaattttt |
156 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7945064 |
ttttacaagttatgagagtctcatattaaatactcaatgttcagactgtagctgtgaagactctgaacagggatgggaatcagggaacaagagaattttt |
7945163 |
T |
 |
| Q |
157 |
tgcagaagttttaatgttgagtatggtgaatcctccaaacctagtgaagcttgttggttattgtgtacaagatgatc |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7945164 |
cgcagaagttttaatgttgagtatggtgaatcatccaaacctagtgaagcttgttggttattgtgtagaagatgatc |
7945240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 31 - 101
Target Start/End: Original strand, 7944990 - 7945060
Alignment:
| Q |
31 |
ttcttgttgtacaagtttgtttcttgttttacaagttatgtgagtctcatattaaatacttaatgttcaga |
101 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
7944990 |
ttcttgtagtacaagtttgtttcttgttttacaagttatgtgagtctcatattaaatactcaatgttcaga |
7945060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University