View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0288_high_13 (Length: 277)
Name: NF0288_high_13
Description: NF0288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0288_high_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 22 - 250
Target Start/End: Complemental strand, 42682516 - 42682288
Alignment:
Q |
22 |
gcagagatttgaagccttggaatgagttcttgaccataattgtatttggatctaaaaacttaaacccatatggcatcctttttaccgtaagattccaacc |
121 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
42682516 |
gcagagatttgaagccttggaatgagttcttgaccataattgtatttggatctaaaaacttaaacccatatggcatcctttttaccctaagattccaacc |
42682417 |
T |
 |
Q |
122 |
tacttacatcatagaagacaaattgacttctttagaaactttaagcctaagacctccatgaatcttgggttgatatacatcagaccaagctaccatatgc |
221 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42682416 |
tacttacatcatagaagacaaattgacttctttagaaactttaagcctaagacctccatgaatcttgggttgatatacatcagaccaagctaccatatgc |
42682317 |
T |
 |
Q |
222 |
attttccctttgatatgcattgtctcccc |
250 |
Q |
|
|
|||||||||||||||| |||||||||||| |
|
|
T |
42682316 |
attttccctttgatatacattgtctcccc |
42682288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1176 times since January 2019
Visitors: 2573