View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0288_high_17 (Length: 226)
Name: NF0288_high_17
Description: NF0288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0288_high_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 191
Target Start/End: Complemental strand, 43183764 - 43183574
Alignment:
Q |
1 |
tgacaagggagaagtgcgtaggagtgaataacaagggagtgagttggggacatacttcggtgattggaagacggagagagatggaagacgccgtcgctgt |
100 |
Q |
|
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43183764 |
tgacaagggagaagtgcgtaggaatgaataacaagggagtgagttggggacatacttcggtgattggaagacggagagagatggaagacgccgtcgctgt |
43183665 |
T |
 |
Q |
101 |
tattccgggattcatgtcacgcacttgcgatcacgtcggcggttgtactgctcctggttctagatcctccggcgagatcagtcctattcat |
191 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43183664 |
tattccgggattcatgtcacgcacttgcgatcacgtcggcggttgtactgctcctggttctagatcctccggcgagatcagtcctattcat |
43183574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University