View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0288_high_21 (Length: 209)
Name: NF0288_high_21
Description: NF0288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0288_high_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 20 - 158
Target Start/End: Original strand, 43183650 - 43183788
Alignment:
Q |
20 |
atgaatcccggaataacagcgacggcgtcttccatctctctccgtcttccaatcaccgaagtatgtccccaactcactcccttgttattcattcctacgc |
119 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43183650 |
atgaatcccggaataacagcgacggcgtcttccatctctctccgtcttccaatcaccgaagtatgtccccaactcactcccttgttattcattcctacgc |
43183749 |
T |
 |
Q |
120 |
acttctcccttgtcacagccgtcaccaccacctcctccg |
158 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43183750 |
acttctcccttgtcacagccgtcaccaccacctcctccg |
43183788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1225 times since January 2019
Visitors: 2574