View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0288_high_24 (Length: 202)

Name: NF0288_high_24
Description: NF0288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0288_high_24
NF0288_high_24
[»] chr8 (1 HSPs)
chr8 (15-158)||(43183645-43183788)


Alignment Details
Target: chr8 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 15 - 158
Target Start/End: Original strand, 43183645 - 43183788
Alignment:
15 gtgagatgaatcccggaataacagcgacggcgtcttccatctctctccgtcttccaatcaccgaagtatgtccccaactcactcccttgttattcattcc 114  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43183645 gtgacatgaatcccggaataacagcgacggcgtcttccatctctctccgtcttccaatcaccgaagtatgtccccaactcactcccttgttattcattcc 43183744  T
115 tacgcacttctcccttgtcacagccgtcaccaccacctcctccg 158  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
43183745 tacgcacttctcccttgtcacagccgtcaccaccacctcctccg 43183788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University