View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0288_high_25 (Length: 202)

Name: NF0288_high_25
Description: NF0288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0288_high_25
NF0288_high_25
[»] chr6 (1 HSPs)
chr6 (133-202)||(26828594-26828663)


Alignment Details
Target: chr6 (Bit Score: 66; Significance: 2e-29; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 26828594 - 26828663
Alignment:
133 atgaagcatggaggaggacgaggttttcaccaatccgtacggaaagagtaaatcagataaggatcagatt 202  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
26828594 atgaagcatggaggaggacgaggttttcaccaatccatacggaaagagtaaatcagataaggatcagatt 26828663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University