View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0288_high_25 (Length: 202)
Name: NF0288_high_25
Description: NF0288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0288_high_25 |
 |  |
|
[»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 66; Significance: 2e-29; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 26828594 - 26828663
Alignment:
Q |
133 |
atgaagcatggaggaggacgaggttttcaccaatccgtacggaaagagtaaatcagataaggatcagatt |
202 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
26828594 |
atgaagcatggaggaggacgaggttttcaccaatccatacggaaagagtaaatcagataaggatcagatt |
26828663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University