View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0288_low_10 (Length: 366)
Name: NF0288_low_10
Description: NF0288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0288_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 3e-98; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 3e-98
Query Start/End: Original strand, 166 - 355
Target Start/End: Original strand, 40482502 - 40482691
Alignment:
| Q |
166 |
agtatttaaccccaagcaccttccaagaaatatatcatgtgtgaagtaaagtggtcgtttgtaatttgtattgtaataccttccacactatccacagtac |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40482502 |
agtatttaaccccaagcaccttccaagaaatatatcatgtgtgaagtaaagtggtcgtttgtaatttgtattgtaataccttccacactatccacagtac |
40482601 |
T |
|
| Q |
266 |
aaaatatactcaatgcatttttgtggttatacttttatcgttactttcagacctgatcacctaaattggaacccatgaatgaaacttcat |
355 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40482602 |
aaaatatactcaatgtatttttgtggttatacttttatcgttactctcagacctgatcacctaaattggaacccatgaatgaaacttcat |
40482691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 29 - 105
Target Start/End: Original strand, 40482324 - 40482400
Alignment:
| Q |
29 |
agttcgttcaatagttgcttgactctagctcacacgacacttgtaagtcaatgacctcaaatttgatattttgttac |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40482324 |
agttcgttcaatagttgcttgactctagctcacacgacacttgtaagtcaatgatctcaaatttgatattttgttac |
40482400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 30 - 156
Target Start/End: Original strand, 40492783 - 40492913
Alignment:
| Q |
30 |
gttcgttcaatagttgcttgactctagctcacacgacacttgtaagtcaatgacctc-aaatttgatattttgttactatgaatttatccaatataaaa- |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| | || || |||||||||||||| |||| |||||| ||||||||||||| |
|
|
| T |
40492783 |
gttcgttcaatagttgcttgactctagctcacacgacacttgtaagtctacgatgtcaaaatttgatattttattacactgaattcatccaatataaaaa |
40492882 |
T |
|
| Q |
128 |
--gttacgaaaacataaaactaattaagtat |
156 |
Q |
| |
|
||| ||||||||||||| |||||||||| |
|
|
| T |
40492883 |
attttaagaaaacataaaacgaattaagtat |
40492913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 128 - 169
Target Start/End: Original strand, 40482396 - 40482437
Alignment:
| Q |
128 |
gttacgaaaacataaaactaattaagtatgtaaaaaatagta |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40482396 |
gttacgaaaacataaaactaattaagtatgtaaaaaatagta |
40482437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 216 - 248
Target Start/End: Original strand, 40494070 - 40494102
Alignment:
| Q |
216 |
gtggtcgtttgtaatttgtattgtaataccttc |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
40494070 |
gtggtcgtttgtaatttgtattgtaataccttc |
40494102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 763 times since January 2019
Visitors: 2568