View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0288_low_11 (Length: 326)
Name: NF0288_low_11
Description: NF0288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0288_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 37 - 257
Target Start/End: Original strand, 2437626 - 2437849
Alignment:
| Q |
37 |
atggcattccctggcctaattgtaactttagcatcaagcaaactaaagttaacaataggtcaggtcaaaacttgttcaactggtaaccgaaccaaatcac |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2437626 |
atggcattccctggcctaattgtaactttagcattaagcaaactatagttaacaataggtcaggtcaagacttgttcaactggtaaccgaaccaaatcac |
2437725 |
T |
 |
| Q |
137 |
attaaaatagaaatactt---atcttaatttgcgattgtaatatgatacataactttagaacaaaaaatgtgacttatgttttgaagtttcatcctttct |
233 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2437726 |
attaaaatagaaatatttatcatcttaatttgcgattgtaatatgatacataactttagaacaaaaaatgtgacttatgttttgaagtttcatcctttct |
2437825 |
T |
 |
| Q |
234 |
ctcgagttcacatcgatcctacat |
257 |
Q |
| |
|
||||||||||| ||||| |||||| |
|
|
| T |
2437826 |
ctcgagttcacgtcgattctacat |
2437849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 263 - 297
Target Start/End: Original strand, 2440162 - 2440196
Alignment:
| Q |
263 |
tttgacagtttgcgcttcatatcattggtccatca |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
2440162 |
tttgacagtttgcgcttcatatcattggtccatca |
2440196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University