View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0288_low_17 (Length: 272)
Name: NF0288_low_17
Description: NF0288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0288_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 248; Significance: 1e-138; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 9 - 268
Target Start/End: Original strand, 4777107 - 4777366
Alignment:
Q |
9 |
agcagagagctatggattttgggtgcaaggacgttaatgtttggaaagaagcactttcaacttacacatctcaagtacaatcactttctctctccaaaaa |
108 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
4777107 |
agcagaaagctatggattttgggtgcaaggacgttaatgtttggaaagaagcactttcaacttacacatctcaagtgcaatcactttctctctccaaaaa |
4777206 |
T |
 |
Q |
109 |
caaacccaatttagtttctcttaaccaattttattgcaatgaactaccttccctcattcaccaacgaaaccctaacccttttatcactacccaagaactc |
208 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4777207 |
caaacccaatttagtttctcttaaccaattttattgcaatgaactaccttccctcattcaccaacgaaaccctaacccttttatcactacccaagaactc |
4777306 |
T |
 |
Q |
209 |
tccaaactcatgcaatggaaactcacacgtggcaaatggaggttaatcactcactcactc |
268 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
4777307 |
tccaaactcatgcaatggaaactcacacgtggcaaatggaggttgatcactcactcactc |
4777366 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 16 - 74
Target Start/End: Original strand, 4784645 - 4784703
Alignment:
Q |
16 |
agctatggattttgggtgcaaggacgttaatgtttggaaagaagcactttcaacttaca |
74 |
Q |
|
|
||||||||||||||| | ||||||||||| |||||||| ||||| ||||||||||||| |
|
|
T |
4784645 |
agctatggattttggattcaaggacgttagcgtttggaaggaagcgctttcaacttaca |
4784703 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University
This website was viewed 3960 times since January 2019
Visitors: 5681