View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0290_high_12 (Length: 220)
Name: NF0290_high_12
Description: NF0290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0290_high_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 107; Significance: 8e-54; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 1 - 127
Target Start/End: Original strand, 37727272 - 37727398
Alignment:
| Q |
1 |
aggcccaaaggtaatgcagaaatctatctatccccagtcaagaaaggggaggttggagtatccaccttcaggaggaggctgcagtgacggaggtaaattg |
100 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
37727272 |
aggcccaaaggtaacgcacaaatctatctatccccagtcgagaaaggggaggttggagtatccaacttcaggaggaggctgcagtgacggaggtaaattg |
37727371 |
T |
|
| Q |
101 |
ccgaatgagactcccatggtatctcct |
127 |
Q |
| |
|
||||||||||| ||||||||||||||| |
|
|
| T |
37727372 |
ccgaatgagacacccatggtatctcct |
37727398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 982 times since January 2019
Visitors: 2571