View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0290_low_9 (Length: 250)
Name: NF0290_low_9
Description: NF0290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0290_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 42708596 - 42708817
Alignment:
| Q |
1 |
ttgatgttggctcagatgatgaagtaaataaagttaattgaacagaaggaaaagcgcacgcagatcttttttgtggtattgccagcaaagttatcatgct |
100 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42708596 |
ttgatgtgggctcagatgacgaagtaaataaagttaattgagcagaaggaaaagcgcacgcagatcttttttgtggtattgccagcaaagttatcatgct |
42708695 |
T |
|
| Q |
101 |
ttgtggggtcttatacaactagggtttaacattctttatcaattccattattcttgaaacagatttctgtgtagagaaagtcattccacgtgtctggtat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42708696 |
ttgtggggtcttatacaactagggtttaacattctttatcaattccaatattcttgaaacagatttctgtgtagagaaagtcattccacgtgtctggtat |
42708795 |
T |
|
| Q |
201 |
ttcagatgagcaccaattgaat |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
42708796 |
ttcagatgagcaccaattgaat |
42708817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 602 times since January 2019
Visitors: 2567