View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0291-INSERTION-1 (Length: 225)
Name: NF0291-INSERTION-1
Description: NF0291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0291-INSERTION-1 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 8 - 71
Target Start/End: Original strand, 46163215 - 46163278
Alignment:
| Q |
8 |
ggaaagatataaacgaattgcgggaggagaaaactgtaaatttgggaaacagagaagatagttg |
71 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46163215 |
ggaaagatataaacgaattgcgggaggagaaaactgtaaatttgggaaacagagaagatagttg |
46163278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 125 - 187
Target Start/End: Original strand, 46163332 - 46163394
Alignment:
| Q |
125 |
tatcttgtcatactttttggttttgtgggaaatagaaacattggaagaaagttcgagagaatt |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
46163332 |
tatcttgtcatactttttggttttgtgggagatagaaacatgggaagaaagttcgagagaatt |
46163394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 184 - 225
Target Start/End: Original strand, 29320050 - 29320091
Alignment:
| Q |
184 |
aattgatgttttttaatgaaatttagatgagttgtgtctcag |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29320050 |
aattgatgttttttaatgaaatttagatgagttgtgtctcag |
29320091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 8572 times since January 2019
Visitors: 8136