View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0291-INSERTION-1 (Length: 225)

Name: NF0291-INSERTION-1
Description: NF0291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0291-INSERTION-1
NF0291-INSERTION-1
[»] chr7 (2 HSPs)
chr7 (8-71)||(46163215-46163278)
chr7 (125-187)||(46163332-46163394)
[»] chr1 (1 HSPs)
chr1 (184-225)||(29320050-29320091)


Alignment Details
Target: chr7 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 8 - 71
Target Start/End: Original strand, 46163215 - 46163278
Alignment:
8 ggaaagatataaacgaattgcgggaggagaaaactgtaaatttgggaaacagagaagatagttg 71  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46163215 ggaaagatataaacgaattgcgggaggagaaaactgtaaatttgggaaacagagaagatagttg 46163278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 125 - 187
Target Start/End: Original strand, 46163332 - 46163394
Alignment:
125 tatcttgtcatactttttggttttgtgggaaatagaaacattggaagaaagttcgagagaatt 187  Q
    |||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||    
46163332 tatcttgtcatactttttggttttgtgggagatagaaacatgggaagaaagttcgagagaatt 46163394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 184 - 225
Target Start/End: Original strand, 29320050 - 29320091
Alignment:
184 aattgatgttttttaatgaaatttagatgagttgtgtctcag 225  Q
    ||||||||||||||||||||||||||||||||||||||||||    
29320050 aattgatgttttttaatgaaatttagatgagttgtgtctcag 29320091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University