View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0291-INSERTION-3 (Length: 187)
Name: NF0291-INSERTION-3
Description: NF0291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0291-INSERTION-3 |
 |  |
|
[»] scaffold0028 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 7e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 7e-91
Query Start/End: Original strand, 1 - 186
Target Start/End: Complemental strand, 23697385 - 23697198
Alignment:
Q |
1 |
ataaatcagatatatggattcatgtttgttcatttattccattttctgacacaggtttaagttagaggtggaagttgaatataatggagttgaaac--ag |
98 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
T |
23697385 |
ataaatcagatatatggattcatgtttgttcatttattccattttctgacacaggtttaagttagaggtggaagttgaatataatggagttgaaacaaag |
23697286 |
T |
 |
Q |
99 |
ttctttctctgggatcgtgagtgcaatgaattgcttggaactacagctacggatcctcaaagggccatgactgaggttttttctttaa |
186 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| |
|
|
T |
23697285 |
ttctttctctgggatcgtgagtgcaatgaattgcttggaactacagctgcggatcttcaaagggccatgactgaggttttttctttaa |
23697198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 59; Significance: 3e-25; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 52 - 175
Target Start/End: Complemental strand, 22078330 - 22078205
Alignment:
Q |
52 |
caggtttaagttagaggtggaagttgaatataatggagttgaaac--agttctttctctgggatcgtgagtgcaatgaattgcttggaactacagctacg |
149 |
Q |
|
|
|||||||||||| || |||||||| |||||||||| ||||| ||| | || || || ||||||||||||||||||||||||||||||||||||||| | |
|
|
T |
22078330 |
caggtttaagttggaagtggaagtcgaatataatgaagttgcaactaaatttttcctatgggatcgtgagtgcaatgaattgcttggaactacagctgct |
22078231 |
T |
 |
Q |
150 |
gatcctcaaagggccatgactgaggt |
175 |
Q |
|
|
|||| |||||||| |||| ||||||| |
|
|
T |
22078230 |
gatcttcaaagggtcatggctgaggt |
22078205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 56 - 177
Target Start/End: Complemental strand, 123546 - 123423
Alignment:
Q |
56 |
tttaagttagaggtggaagttgaatataatggagttgaaac--agttctttctctgggatcgtgagtgcaatgaattgcttggaactacagctacggatc |
153 |
Q |
|
|
|||||||| ||| ||||||| |||||||||||| ||| ||| |||| || |||||||||||||||||||| |||||||||||||||||||| | |||| |
|
|
T |
123546 |
tttaagttggagctggaagtggaatataatggatttgcaactaagtttttcttctgggatcgtgagtgcaatcaattgcttggaactacagctgctgatc |
123447 |
T |
 |
Q |
154 |
ctcaaagggccatgactgaggttt |
177 |
Q |
|
|
||||||| |||| |||||||| |
|
|
T |
123446 |
tgcaaagggttatgattgaggttt |
123423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University