View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0291_high_10 (Length: 251)
Name: NF0291_high_10
Description: NF0291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0291_high_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 28742711 - 28742951
Alignment:
| Q |
1 |
tgataacattatatgtatctgtgttcgggtgagcggctattctaattannnnnnnnnnnnggttgctgagaagggagggtatcaacaacaatgaaggaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28742711 |
tgataacattatatgtatctgtgttcgtgtgagcggctattctaattattttttatttttggttgctgagaagggagggtatcaacaacaatgaaggaat |
28742810 |
T |
|
| Q |
101 |
aagaataggatagaagcaaaaggagatgatacttatgataaaatatttgtgcttcttctgacagtagccatcagccagtggagatgaggcagccaaactg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28742811 |
aagaataggatagaagcaaaaggagatgatacttatgataaaatacttgtgcgtcttctgacagtagccatcagccagtggagatgaggcagccaaactg |
28742910 |
T |
|
| Q |
201 |
ccaaaacataaagcacacgcaagattcgccttggagaataa |
241 |
Q |
| |
|
|||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
28742911 |
ccaaaacataaagcacacacaagattcaccttggagaataa |
28742951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 19 times since January 2019
Visitors: 8139