View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0291_high_3 (Length: 480)
Name: NF0291_high_3
Description: NF0291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0291_high_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 128; Significance: 6e-66; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 128; E-Value: 6e-66
Query Start/End: Original strand, 288 - 467
Target Start/End: Original strand, 18748419 - 18748598
Alignment:
| Q |
288 |
ggtgatgatttgaagagaataatatgaaaatgggtgataaatatgacactcaatccttcaacaatattgaaggtatatcaatcttaagtctttgatataa |
387 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
18748419 |
ggtgatgatttgaagagattcatatgaaaatgggtgataaatatgacactcaatccctcaacaatattaaaggtatatcaatcttgagtctttgatataa |
18748518 |
T |
 |
| Q |
388 |
nnnnnnnngatttatttaatcttcttggatgtaacttgtgggtattttatgtctacaatttttatttgttgatatgattc |
467 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
18748519 |
ttttttttgatttatttaatcttcttggatgtaacttgtgggtattttatgtttacaatttttatttgctgatatgattc |
18748598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 29 - 175
Target Start/End: Original strand, 18748166 - 18748312
Alignment:
| Q |
29 |
acattcttgagcgaaacatatcatattaaaataaatgatacctcatacccatagtaccaataaagttataacannnnnnngacatattttacttctcaca |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
18748166 |
acattcttgagcgaaacatatcatattaaaataaatgatacctcatactcatagtaccaataaagttataacatttttttgacatattttacttctcaca |
18748265 |
T |
 |
| Q |
129 |
gtaagtgtaatttctcaattctcaaggacgcggtgagttggttctag |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
18748266 |
gtaagtgtaatttctcaattctcaaggacgtggtgagttgcttctag |
18748312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University