View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0291_high_7 (Length: 301)
Name: NF0291_high_7
Description: NF0291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0291_high_7 |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 66 - 301
Target Start/End: Complemental strand, 36632712 - 36632482
Alignment:
Q |
66 |
tctggtacctcaatttcaggctctggtggctcctcctcgtacctgcatcgttttaatcatgagtaataatacaaaccctaattaattatgtgagtgagag |
165 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36632712 |
tctggtacctcaatttcaggctctggtggctcctcctcgtacctgcatcgttttaatcatgagtaataatacaaaccctaattaattatgtgagtgagag |
36632613 |
T |
 |
Q |
166 |
agggaaatagaaagagaaccccatgtcgatatcttcgtagtcatcgtcggccatggttgttgaattgaggaaggtaacctctgctctgctagcttaagaa |
265 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
36632612 |
agggaaatagaaagagaaccccatgtcgatatcttcgtagtcatcgtcggccatggttgttgaattgaggaaggtaacctc-----tgctagcttaagaa |
36632518 |
T |
 |
Q |
266 |
gaccgctgccctaaaaccccactcggacggaatgaa |
301 |
Q |
|
|
||| |||||||||||||||||||||||||||||||| |
|
|
T |
36632517 |
gactgctgccctaaaaccccactcggacggaatgaa |
36632482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7 times since January 2019
Visitors: 8137