View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0291_low_11 (Length: 265)

Name: NF0291_low_11
Description: NF0291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0291_low_11
NF0291_low_11
[»] chr5 (1 HSPs)
chr5 (13-133)||(39185319-39185439)


Alignment Details
Target: chr5 (Bit Score: 105; Significance: 2e-52; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 13 - 133
Target Start/End: Complemental strand, 39185439 - 39185319
Alignment:
13 agaacctgtggtttgtgtttttgtttcagattcgttgttgtatcttcgaattcgagtttgggactcttaggattggggtttatatcgttctgttgggtct 112  Q
    |||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||||||    
39185439 agaacctgtgttttgtgtttttgtttcagattcgttgttgtatctttgaattcgagtttgggtctcttaggattggggtttctatcgttctgttgggtct 39185340  T
113 ctgagacttgctgctattgct 133  Q
    |||||||||||||||||||||    
39185339 ctgagacttgctgctattgct 39185319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University