View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0291_low_11 (Length: 265)
Name: NF0291_low_11
Description: NF0291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0291_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 105; Significance: 2e-52; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 13 - 133
Target Start/End: Complemental strand, 39185439 - 39185319
Alignment:
Q |
13 |
agaacctgtggtttgtgtttttgtttcagattcgttgttgtatcttcgaattcgagtttgggactcttaggattggggtttatatcgttctgttgggtct |
112 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
T |
39185439 |
agaacctgtgttttgtgtttttgtttcagattcgttgttgtatctttgaattcgagtttgggtctcttaggattggggtttctatcgttctgttgggtct |
39185340 |
T |
 |
Q |
113 |
ctgagacttgctgctattgct |
133 |
Q |
|
|
||||||||||||||||||||| |
|
|
T |
39185339 |
ctgagacttgctgctattgct |
39185319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University