View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0291_low_12 (Length: 256)
Name: NF0291_low_12
Description: NF0291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0291_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 27 - 241
Target Start/End: Complemental strand, 5402222 - 5402008
Alignment:
| Q |
27 |
acatctaagtattagcatcacaaatcttaatatatagcattacaccaagcata----gtatatagtgaaaataaaatgaactggtggttggctagagcaa |
122 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5402222 |
acatccaagtattagcatcacaaatcttaata----gcattacaccaagcatatatagtatatagtgaaaataaaatgaactggtggttggctagagcaa |
5402127 |
T |
 |
| Q |
123 |
ctggtgatcatcctggcaaggcaagttcttacgaacaaaatttgttctatatttttcattttaatgctaattaatttgatatatctattatgaatgacaa |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5402126 |
ctggtgatcatcctggcaaggcaagttcttacgaactaaatttgttctatatttttcattttaatgctaattaatttgatatatctattatgaatgacaa |
5402027 |
T |
 |
| Q |
223 |
taagcactgggcaatgagg |
241 |
Q |
| |
|
||| |||||||||| |||| |
|
|
| T |
5402026 |
taaacactgggcaacgagg |
5402008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University