View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0292_high_8 (Length: 286)
Name: NF0292_high_8
Description: NF0292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0292_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 208
Target Start/End: Original strand, 21919256 - 21919463
Alignment:
Q |
1 |
ttcacgcgcttggttgaggtgttttcgggccgcgccggaggaggagggtggtttaggtgttggtatagtgaaacattgaggagttcagtttgtgaaggtg |
100 |
Q |
|
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
21919256 |
ttcacgcgattggttgaggtgttttcgggccgcgccggaggaggagggtggtttaggtgttggtatagtgaaacattgaggagttcaatttgtgaaggtg |
21919355 |
T |
 |
Q |
101 |
ggagagtgaggatggtggtggagaggattggaatggcaaagggtggtgagagtttgggtgatgttatttgaagaagtgaagatgaggagttgcctttgtt |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
21919356 |
ggagagtgaggatggtggtggagaggattggaatggcaaagggtggtgagagtttgggtgatgttattggaagaagtgaagatgaggagttgcctttgtt |
21919455 |
T |
 |
Q |
201 |
tgatgatg |
208 |
Q |
|
|
|||||||| |
|
|
T |
21919456 |
tgatgatg |
21919463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University