View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0292_low_10 (Length: 286)

Name: NF0292_low_10
Description: NF0292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0292_low_10
NF0292_low_10
[»] chr3 (1 HSPs)
chr3 (1-208)||(21919256-21919463)


Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 208
Target Start/End: Original strand, 21919256 - 21919463
Alignment:
1 ttcacgcgcttggttgaggtgttttcgggccgcgccggaggaggagggtggtttaggtgttggtatagtgaaacattgaggagttcagtttgtgaaggtg 100  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
21919256 ttcacgcgattggttgaggtgttttcgggccgcgccggaggaggagggtggtttaggtgttggtatagtgaaacattgaggagttcaatttgtgaaggtg 21919355  T
101 ggagagtgaggatggtggtggagaggattggaatggcaaagggtggtgagagtttgggtgatgttatttgaagaagtgaagatgaggagttgcctttgtt 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
21919356 ggagagtgaggatggtggtggagaggattggaatggcaaagggtggtgagagtttgggtgatgttattggaagaagtgaagatgaggagttgcctttgtt 21919455  T
201 tgatgatg 208  Q
    ||||||||    
21919456 tgatgatg 21919463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University