View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0293_low_3 (Length: 362)
Name: NF0293_low_3
Description: NF0293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0293_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 96 - 350
Target Start/End: Complemental strand, 34670310 - 34670056
Alignment:
Q |
96 |
agtttggtctagtttcagttccatcaaggtttgcaaaatgtacttgagtttgattcaagggagaaagttctaccatctgctttttattagatgataacag |
195 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34670310 |
agtttggtctagtttcagttccatcaaggtttgcaaaatgtacttgagtttgattcaagggagaaagttctaccatctgctttttattagatgataacag |
34670211 |
T |
 |
Q |
196 |
ctcattttcaaaattagaactattaaaaggattgttgtaaattgcttcacctctcaaaagttcttcaattcctaactctgagaataacctcttccgagta |
295 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34670210 |
ctcattttcaaaattagaactattaaaaggattgttgtaaattgcttcacctctcaaaagctcttcaattcctaactctgagaataacctcttccgagta |
34670111 |
T |
 |
Q |
296 |
ttattagtcggtgtaccggtattcaactctgatatgcattcagaaaagccagtat |
350 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34670110 |
ttatcagtcggtgtaccggtattcaactctgatatgcattcagaaaagccagtat |
34670056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University