View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0294_low_4 (Length: 365)
Name: NF0294_low_4
Description: NF0294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0294_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 98 - 340
Target Start/End: Complemental strand, 2097284 - 2097042
Alignment:
| Q |
98 |
attctgaagattaatcatgtgggagtttcaaaggctctttatctgaaggagtttttgaggnnnnnnnnacgagttttaggtctaagaaaaaccaaggttt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||| |||| |
|
|
| T |
2097284 |
attctgaagattaatcatgtgggagtttcaaaggctctttatctgaaggagtttttgag-ttttttttacgagtcttaggtctaagaaaaaccaaagttt |
2097186 |
T |
 |
| Q |
198 |
ggtctggcttt-agtttggcacgttgttgtgtggaccatttggaatttctgcaatgaaatgatttaatttctccaggggtcttggtttggctgtatcatt |
296 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2097185 |
ggtctggcttttagtttggcacgttgttgtgtgaaccatttggaatttctgcaatgaaatgatttaatttctccaggggtcttggtttggctgtatcatt |
2097086 |
T |
 |
| Q |
297 |
ggttctctctgatgttgggggttctgtggggggtttctctgctg |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2097085 |
ggttctctctgatgttgggggttctgtggggggtttctctgctg |
2097042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University