View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0294_low_9 (Length: 281)
Name: NF0294_low_9
Description: NF0294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0294_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 46 - 221
Target Start/End: Complemental strand, 1340021 - 1339846
Alignment:
| Q |
46 |
aggcttgtcgaagaacaaattgacaaaaagattgttttgtcaatgagagctatttatcagtcaagaataggtcttggtctaatggacataggtatgtggg |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
1340021 |
aggcttgtcgaagaacaaattgacaaaaagattgttttgtcaatgagagctatttatcagtcaaaaataggtcttggtctaatggacataggtatgtggg |
1339922 |
T |
 |
| Q |
146 |
ttgtttatttctttctttcttttaatagttgaaagaaattgtaggctaaatgtatatttgacaggattgatgatgt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1339921 |
ttgtttatttctttctttcttttaatagttgaaagaaattgtaggctaaatgtatatttgacaggattgatgatgt |
1339846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University