View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0295-INSERTION-4 (Length: 397)
Name: NF0295-INSERTION-4
Description: NF0295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0295-INSERTION-4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 8 - 380
Target Start/End: Complemental strand, 641829 - 641456
Alignment:
| Q |
8 |
cttttcactgatggaaaaagatgtgtgacnnnnnnnnn--gtaggaaagttgaagtgaattggattgatgtaaaatgcagagatcgcgtaaagctcttca |
105 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
641829 |
cttttcactgatggaaaaagatgtgtgactttttttttttgtaggaaagttgaagtgaattggattgatgtaaaatgcagagatcgcgtaaagctcttca |
641730 |
T |
|
| Q |
106 |
acaaagaagatctttagagaaggctgcaagtgggcgaaattgtctttataaagtttctctgtctttggtttttattttgtggggattggttttcctcttc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
641729 |
acaaagaagatctttagagaaggctgcaagtgggagaaattgtctttataaagtttctctgtctttggtttttattttgtggggattggttttcctcttc |
641630 |
T |
|
| Q |
206 |
agcttatggataagttgtggcaacggatatggaggtatctttttctttccgatgaccttannnnnnnnnnattaaaggtgttgaagtatggttttgtttt |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
641629 |
agcttatggataagttgtggcaacggatatggaggtatctttttctttccgatgacctt-ttttttttttattaaaggtgtttaagtatggttttgtttt |
641531 |
T |
|
| Q |
306 |
ggtagttgactacatggacttgattttgtgattgtgttgcaagtttttgcttagttggcttatgtgatatttttc |
380 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
641530 |
ggtagttgactacatggacttgattttgtgattgtgttgcaagtttttgcttagttggcttatgtgatatttttc |
641456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 215 times since January 2019
Visitors: 2563