View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0295_high_7 (Length: 270)
Name: NF0295_high_7
Description: NF0295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0295_high_7 |
 |  |
|
[»] scaffold0929 (1 HSPs) |
 |  |
|
[»] chr7 (3 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0929 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: scaffold0929
Description:
Target: scaffold0929; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 7 - 270
Target Start/End: Complemental strand, 1484 - 1221
Alignment:
Q |
7 |
ggagcagagagcaaattatgctctgtaagcttcaacatgtgtggggcgcactgggtctgtgtgcggggtgcatggatcagaggctttttccgttgttttc |
106 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||| |
|
|
T |
1484 |
ggagcagagagcaaattatgctctgtaagcttcaacatgtgtggggcgcactgggtctgtgtgtggggtgcatggatcagaggctttttccattgttttc |
1385 |
T |
 |
Q |
107 |
ttcattcttcttgtttatttcatccttgatatgagcttgagacttagggacaaagttcccccaagttatttggtcttcatatgtttcattgtattgatct |
206 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1384 |
ttcattcttcttgtttatttcatccttgatatgagcttgggacttagggacaaagttcccccaagttatttggtcttcatatgtttcattgtattgatct |
1285 |
T |
 |
Q |
207 |
tctggcttccataactttcaagagatatcttggtggacttactttcatgatttataccaaaaaa |
270 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
1284 |
tctggcttccataactttcaagagatatcttggttgacttactttcatgatttataccaaaaaa |
1221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 120; Significance: 2e-61; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 91 - 270
Target Start/End: Complemental strand, 6370437 - 6370259
Alignment:
Q |
91 |
tttttccgttgttttcttcattcttcttgtttatttcatccttgatatgagcttgagacttagggacaaagttcccccaagttatttggtcttcatatgt |
190 |
Q |
|
|
||||||| |||||||||||||||||| ||||||||||||||||||||||||||| || || |||||||| ||||||||| |||||| |||||||||||| |
|
|
T |
6370437 |
tttttcccttgttttcttcattcttcatgtttatttcatccttgatatgagctttggattt-gggacaaaattcccccaaattatttagtcttcatatgt |
6370339 |
T |
 |
Q |
191 |
ttcattgtattgatcttctggcttccataactttcaagagatatcttggtggacttactttcatgatttataccaaaaaa |
270 |
Q |
|
|
||||||||||||||||||| ||| |||||||||||||||||| ||||||| |||||||||||||||||||||| |||||| |
|
|
T |
6370338 |
ttcattgtattgatcttctagctcccataactttcaagagatgtcttggttgacttactttcatgatttatactaaaaaa |
6370259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 91 - 270
Target Start/End: Complemental strand, 6378902 - 6378724
Alignment:
Q |
91 |
tttttccgttgttttcttcattcttcttgtttatttcatccttgatatgagcttgagacttagggacaaagttcccccaagttatttggtcttcatatgt |
190 |
Q |
|
|
||||||| |||||||||||||||||| ||||||||||||||||||||||||||| || || |||||||| ||||||||| |||||| |||||||||||| |
|
|
T |
6378902 |
tttttcccttgttttcttcattcttcatgtttatttcatccttgatatgagctttggattt-gggacaaaattcccccaaattatttagtcttcatatgt |
6378804 |
T |
 |
Q |
191 |
ttcattgtattgatcttctggcttccataactttcaagagatatcttggtggacttactttcatgatttataccaaaaaa |
270 |
Q |
|
|
||||||||||||||||||| ||| |||||||||||||||||| ||||||| |||||||||||||||||||||| |||||| |
|
|
T |
6378803 |
ttcattgtattgatcttctagctcccataactttcaagagatgtcttggttgacttactttcatgatttatactaaaaaa |
6378724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 58 - 148
Target Start/End: Original strand, 24303578 - 24303668
Alignment:
Q |
58 |
tgggtctgtgtgcggggtgcatggatcagaggctttttccgttgttttcttcattcttcttgtttatttcatccttgatatgagcttgaga |
148 |
Q |
|
|
|||||||||||| |||||||||||||||||||| ||||| ||||||||||||| |||| | ||||||| ||||||||||||||||| |
|
|
T |
24303578 |
tgggtctgtgtgtggggtgcatggatcagaggcgatttcctttgttttcttcatccttcatcagattttcatcattgatatgagcttgaga |
24303668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 102 - 151
Target Start/End: Original strand, 9854987 - 9855036
Alignment:
Q |
102 |
ttttcttcattcttcttgtttatttcatccttgatatgagcttgagactt |
151 |
Q |
|
|
||||||||||||||| ||||| |||||||||||||||||| ||| ||||| |
|
|
T |
9854987 |
ttttcttcattcttcatgtttttttcatccttgatatgagtttgggactt |
9855036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 908 times since January 2019
Visitors: 2569